Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST172907
Clone ID OST172907
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST172907
Sequence
GACTGAGGAGACCTGCAGATGCCAAAACAAAGGAACACTTGGGATCCAGACAACATGAAGTAGAATGGCAAACTTACCAG
AGAATTCTGAAAAAGACAAGAGTCATGGAAAAAACCAAGTGGCTGGATATCAAAGGAAATCATGATGCATATGCCATNCC
CAGNCTGGAGAGNATCTCCCTTTATTACAG
Sequence Type mRNA
Unitrap ID UNI25635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120804865..120805016 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054484 (Tmem62) NM_175285 transmembrane protein 62 Gene [Source:MGI (curated);Acc:Tmem62-001]

 
Come back to gene ENSMUSG00000054484


For any suggestions or comments, please send an email to unitrap@crg.es