Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST172850
Clone ID OST172850
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST172850
Sequence
ACTGAGGTGTGACTTATGANGNNCTGTCAGCATTAGGAGACAGTGATGACAAAATCCAACTTCCTATTAAAAANCATGTT
GCCNTATTGNGAAATGGCAGNGAGCAAGTTCAAGTCGCACAGGTTTGCCGACTGCACCATGTTGTTGCTGTCACAGCTAG
AAGCTGGACATCAGGAGACTGTTTGCTGCAGTTAACAAGTGTCCTGATAGACTGCTCACAGCCGAGTCAACAATTCTGTA
TACCACGTTTGATGAAANACTGGCAAAACACATGAGTGATGGTAGCATGAACCAGCTTCCTTGTTTCCTTGGAGAGCCTG
CCATGGAAAAGCCCATGTATCCCCAGNCTNGCGCNNTNTGGCTATGAACATCATTTGGNGGGGGGCTNAGGAGGCCCGCC
CTGCTTGGGCCTGT
Sequence Type mRNA
Unitrap ID UNI25636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15123680..15156435 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073455 (9030025P20Rik) NP_001116844 RIKEN cDNA 9030025P20 gene Gene [Source:MGI Symbol;Acc:MGI:3583895]

 
Come back to gene ENSMUSG00000073455


For any suggestions or comments, please send an email to unitrap@crg.es