Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGA355
Clone ID BGA355
Vector pGT1Lxf
Project baygenomics

Sequence tag BGA355
Sequence
ACTGTGGCCATACCATCTGCCGCCAGTGTCTGGAGAAGCTCCTGGCCAGCAGCATCAATGGCGTCCGCTGCCCCTTTTGC
AGCAAGATTACTCGCATCACCA
Sequence Type mRNA
Unitrap ID UNI6892

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 65274357..65274458 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051675 (Trim32) NM_053084 tripartite motif-containing 32 Gene [Source:MGI (curated);Acc:Trim32-002]

 
Come back to gene ENSMUSG00000051675


For any suggestions or comments, please send an email to unitrap@crg.es