Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST172620
Clone ID OST172620
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST172620
Sequence
ACTGAGCAGCTTTCCCGGCAAAGTGCCCAGANTATCCCGCTGCCCATGTTGCCTCTGGCTGACACTGAAAAGTTGATTCG
CGAGAAGGACGAAGAGCTGCGCCGCATGCAAGAAATGCTGGAGAAGATGCAAGCCCAGATGCAGCAGAGCCAGGCTCAGG
GCGAGCAATCAGATGTGCTGTGATATTCCCCAAAA
Sequence Type mRNA
Unitrap ID UNI25639

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134358262..134358558 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000486 (Sept1) NM_017461 septin 1 Gene [Source:MGI (curated);Acc:Sept1-001]

 
Come back to gene ENSMUSG00000000486


For any suggestions or comments, please send an email to unitrap@crg.es