Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGA391
Clone ID BGA391
Vector pGT1Lxf
Project baygenomics

Sequence tag BGA391
Sequence
ATTTTTGAGACGCATTGAGCTTAAGCAGCCGGTGATGGCGGCAGCAGCCGTGGAGTCTGCGGCGGGTCCGGGCCCATGAG
GCGACGACGGAGGCGGGACGGCTTTTACCTAGCGCCTGACTTCCGACACAGGGAAGCTGAGGACATGGCAGGAGTGTTTG
ACATAGACCTGGACCAGCCAGAAGATGCAGGCTCTGAGGATGAGCTGGAGGAGGG
Sequence Type mRNA
Unitrap ID UNI6893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86358069..86358276 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020516 (Rps6kb1) NM_028259 ribosomal protein S6 kinase, polypeptide 1 Gene [Source:MGI (curated);Acc:Rps6kb1-001]

 
Come back to gene ENSMUSG00000020516


For any suggestions or comments, please send an email to unitrap@crg.es