Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST172441
Clone ID OST172441
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST172441
Sequence
ATGTAGATTCTTTCATGAAGCAGCCTGGGAATGAGACTGCAGATACAGTGTTAAAGAAGCTGGATGAACAATACCAGAAG
TATAAGTTTATGGAACTCAACCTTGCTCAGAAAAAAAGGAGGCTGAAAGGTCAGATTCCTGAAATTAAACAGACTTTGGA
AATTCTGAAATACATGCAGAAGAAAAAAGAGTCTACCAATTCAATGGAGACGAGATTNTTACTGGCCGNTAACCTGTACT
GCAAAGCTTCAGTCCCTCCTACTGATAAAGTATGCCTATGGTTGGGGGCTAATGNANTGCTTGAATATNATATTGATGAA
GCTCAGGCCTTGNTGGAAAAGAATTTATCAACTGCCACAAAGAATCTTGATTCTCTTGAAGAAGACCTTGACTTTCTTCG
AGATCAGNTTACTACCACAGAAGTCNNTATGGCCNGGGTTTATATTTGGGATGTANANCCANCNTTTCATNGATGATTCT
ACCAAGANTNAAGCTTAACACTGGCA
Sequence Type mRNA
Unitrap ID UNI25640

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 72762432..72779325 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031197 (Vbp1) NM_011692 von Hippel-Lindau binding protein 1 Gene [Source:MGI (curated);Acc:Vbp1-001]

 
Come back to gene ENSMUSG00000031197


For any suggestions or comments, please send an email to unitrap@crg.es