Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST172096
Clone ID OST172096
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST172096
Sequence
GCCCAAAGGAGCACCCGGNGCTCCAGGTAGAAGACACGGATGCTGATAGTGGCCCCCTCATCCCANAGGAGACACTCCCT
CCACCTGAGAGACCACCACCGTCTCCTGTCAAGTCGGACACCCTCACAGTTCCCGGCGCCGCTGCAGCAGGCCACAGGTT
ACCCATGATGACTTGCTTGCATCTCTATCTGAGCTGTGCNGGCTGGCTAGCGGGTTTGACAGATGGGGCAGACAATAGAG
ATGGGAAGTAGCAGGACTCAGATCTCCTCTGCCTGCGCGGCTGAGAAGCAGTCTCAGCTGCAAGACAGAGGGATGCTTTG
TAGCAAATGCTATTGTTCACATATACACTAAATGTAACAACTAGCCTCTGCCCCCTTTTTAAATCTTGCTTCAG
Sequence Type mRNA
Unitrap ID UNI25643

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97794467..97794856 383
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031789 (Cngb1) cyclic nucleotide gated channel beta 1 Gene [Source:MGI (curated);Acc:Cngb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143454900..143455289 383
 
EST/CDNA Est Name
  BC045114.1

 
Come back to gene BC045114.1


For any suggestions or comments, please send an email to unitrap@crg.es