Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGB088
Clone ID BGB088
Vector pGT1Lxf
Project baygenomics

Sequence tag BGB088
Sequence
CTTTCTCCAAGCTGTGGCGATGTGTCGGATGCGCAGGGAGCGGCGGGACGGTCTGGAGCAGCGTGAGGGCCTGTGGCATT
GCTCTGCAGGGTCATCTGGGGAGATGCTCGCAGCAGCTGGCTCTGCAGGGAAAACTGACTTCATTTTCCCCGAGGCTGTA
TTCAAAACCTCCCAGAGGGTTTGAGAAGTTTTTTAAGAATAAGAAGAACAGAAAAAGTGCAAACCCAGGAAATTCAGTAC
CTCCAAAAAA
Sequence Type mRNA
Unitrap ID UNI6898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 126001859..126005043 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031967 (Afg3l1) NM_054070 AFG3(ATPase family gene 3)-like 1 (yeast) Gene [Source:MGI (curated);Acc:Afg3l1-001]

 
Come back to gene ENSMUSG00000031967


For any suggestions or comments, please send an email to unitrap@crg.es