Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGB160
Clone ID BGB160
Vector pGT1Lxf
Project baygenomics

Sequence tag BGB160
Sequence
GAAGCCCGCGGCGGACTCGTAGCCTCCCAGTCGGGCTGCGGCCGAGGCCGGTCCTGGCTTTGTAGCTCACTCAAGATGGC
GGCGCAGCCACCCACCGGGATCCGCCTCAGCGC
Sequence Type mRNA
Unitrap ID UNI625

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93832480..93832592 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039456 (Morc3) NP_001038994 microrchidia 3 Gene [Source:MGI Symbol;Acc:MGI:2136841]

 
Come back to gene ENSMUSG00000039456


For any suggestions or comments, please send an email to unitrap@crg.es