Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST171559
Clone ID OST171559
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST171559
Sequence
GACTGAGGTTTAGCACAAAATGAACATAATTAGGGAAAATAAGGATCTGGCATGTTTCTACACAACCAAGCACTCATGGA
GGGGAAAGTATAAACGAGTCTTTTCAGTTGGAACCCATGCAGNTACTACCTATAATCCCAATACCTTAGAAGTAACAAAT
CAGTGGCCTTATGGAGACATTTGTAGCATCAGCCCTGTTGGGAAAGGACAAGGAACAGAGTTCAACCTCACATTTCGTAA
AGGCAGTGGGAAGAAGTCAGAAACGTTGAAGTTTTCTACAGAGCACAGAACAGAGCTGCTTACGGAGGCTTTGGNNANAA
GACCCTTGNCACAAACTNGNTCTCTCTTNTGAANGAGNAGTGGCTNCCTAAGTCTNGAGANGGAGNNCNNCCGNTCTGCC
NANTCCTGNTTTATACTGACCTTTAACTTGACACTGAAACCTTTTNTTTCCCATAAAAAAGT
Sequence Type mRNA
Unitrap ID UNI1455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 104139758..104149172 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054574 (AC145736.4-202) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q8BNL1]

 
Come back to gene ENSMUSG00000054574


For any suggestions or comments, please send an email to unitrap@crg.es