Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST171286
Clone ID OST171286
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST171286
Sequence
GACTGAGGCAGCCCCACCAAAGTCCCTGACACCGAGAANGTGACAAGAATCGAGCGAATCGGCGCTCACTCCCACATCCG
GGGGCTGGGACTGGATGATGCCCTGGAGCCAAGACAGGCTTCCCAGGGAATGGTGGGGCAGCTAGCTTGCCCGGCGTGCA
GCTGGCTGTGGTGCTGGAGATGATCCGAGAAGGGAAGATTGCAGGGCTGGGCCGTCCTCATTGGAGGCCAGCCAGGCACT
TGGGAAGACACNNNTTGCNNTGGGCATGGCCCAGGCACTGGNCCCCGACACACCATTCACAGCCATCGCNGGCAGTGAGA
TCTTTTTTNTGGAGANNAGCANGACTGAGGCTCTAACGCAAGCCTTCCGCCGTTCCATTGGTGTCCGGATCAAGGAGGAN
ACAGAGATCATTGAAGGGGAGGTGGTTGA
Sequence Type mRNA
Unitrap ID UNI14841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52683880..52686746 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003868 (Ruvbl2) NM_011304 RuvB-like protein 2 Gene [Source:MGI (curated);Acc:Ruvbl2-001]

 
Come back to gene ENSMUSG00000003868


For any suggestions or comments, please send an email to unitrap@crg.es