Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST171253
Clone ID OST171253
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST171253
Sequence
GACTGAGGGATATTATGATAACACACTTTGAGCCTTCCTCTCCTTTGAGGGACTTTGCAGTGAGGTTCGAGATATGTGTT
CTTTTGACAATGAGCAGCCGTTCACCATGAAATGGATAGATGAGGAAGGAGACCCATGTACAGTGNCTTCTCNNTTGGAG
TTANAAGAGGCTTTCAGGCTGTACTNAGCCTGAACANGGATTCTGAACTNTTGNTTCATGTATNTCCATGTGTACCANAG
CTNCCTGAANTGCCTTGCCCANGGGAAGACAGTGANNGTNCTANTGCTCTGCACACTTATTACTCACAGNGGAAAACTAA
GAACTTTTTGTTTTGTTNTATNTTTTGAGACAAGGTTTCTGNCTGTCTTGGAACTCTCTTTCTA
Sequence Type mRNA
Unitrap ID UNI9316

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30917470..30925338 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037643 (Prkci) NP_032883 protein kinase C, iota Gene [Source:MGI Symbol;Acc:MGI:99260]

 
Come back to gene ENSMUSG00000037643


For any suggestions or comments, please send an email to unitrap@crg.es