Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRX150
Clone ID RRX150
Vector pGT2Lxf
Project baygenomics

Sequence tag RRX150
Sequence
GTGAGGGAGCAGCAACAGCGGCGGCGGCTGTAGCGGCGGAGGCTTCGGCGACGGCGACAGCGACAGCGACGGGCTCTGGT
GACGACTTCTCTGAGG
Sequence Type mRNA
Unitrap ID UNI6910

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155970671..155970766 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044150 (A830080D01Rik) NM_001033472 RIKEN cDNA A830080D01 gene Gene [Source:MGI Symbol;Acc:MGI:2685992]

 
Come back to gene ENSMUSG00000044150


For any suggestions or comments, please send an email to unitrap@crg.es