Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRX144
Clone ID RRX144
Vector pGT2Lxf
Project baygenomics

Sequence tag RRX144
Sequence
CAGCAAGAAGATGAACCTGGGAGATGGTGCCTACCGGGATGATAACGGAAAACCTTACGTGCTCCCCAGTGTCCGGAAGG
CAGAGGCCCAGATTGCTGCAAAAAATTTGGACAAAGAATACCTGCCCATTGGGGGACTGGCTGAATTCTGTAAGGCTTCT
GCAGAACTGGCCCTGGGCGAGAACAATGAAGTGTTGAAAAGCGGCCG
Sequence Type mRNA
Unitrap ID UNI6912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 98399647..98401691 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031672 (Got2) NM_010325 glutamate oxaloacetate transaminase 2, mitochondrial Gene [Source:MGI (curated);Acc:Got2-001]

 
Come back to gene ENSMUSG00000031672


For any suggestions or comments, please send an email to unitrap@crg.es