Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST171035
Clone ID OST171035
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST171035
Sequence
GACTGAGTTGAGCACTTGCATCTTAAGGAAGGAGAAAATCAGGCCAGATGCCAATGGTGCTGTTGTTAAGACCAATGCAA
ACACAGAGAAGACAGAGGAAGATGAGAAAGAGGACAGAGCTGCTCAGTCTTTACTCAACAAGCTGATCAGAAGCAATCTT
GTGGATAACACCAACCAAGTGGAAGTCCTGCAGAGGGACCCAAGCTCCCCGCTCTACTCAGTGAAGTCCTTCGAAGAGCT
TCGCCTGAAACCACAGCTTCTCCAGGGAGTCTATGCTATGGGTTTCAACCGCCCTTCCAAAATACAGGAAAATGCATTGC
CTTTGATGCTTGCTGAACCGTNTGNAACTCAATATNCCTACATCTGGCATTTACTATTTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI13155

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113513373..113547916 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015023 (Ddx19a) NM_007916 DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a Gene [Source:MGI (curated);Acc:Ddx19a-001]

 
Come back to gene ENSMUSG00000015023


For any suggestions or comments, please send an email to unitrap@crg.es