Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRZ644
Clone ID RRZ644
Vector pGT2Lxf
Project baygenomics

Sequence tag RRZ644
Sequence
TGGGGGCATGTCATCCTATGAAGGCTGCTTGGCTCTCAATGCCAGACCCCAGAGCCCAAGAGAAGGGCACCTGATGGACA
CTTTGTATGCCCAAGTAAAGAAACCTCGGATCTCCAAACTTGGAGA
Sequence Type mRNA
Unitrap ID UNI6919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129998387..129998512 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025812 (Pard3) NM_033620 par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]

 
Come back to gene ENSMUSG00000025812


For any suggestions or comments, please send an email to unitrap@crg.es