Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST170880
Clone ID OST170880
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST170880
Sequence
GCTCGGTCACTAAGAAGCCTGTCATATCATGCCCCNGGNNCGTGGCTTNNNGATATACCACAGTCAACAGAGCAGTATGA
TCCATTTGCTGAGCATCGTCCTCCAAAGATTGCCGATCGGGAAGATGAATACAAAAAAGCATAGGCGGACCATGATAATT
TTCCCCAGAGCGTCTTGATCCTTTTGCAGATGGCTTCTAT
Sequence Type mRNA
Unitrap ID UNI25671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 55073219..55073695 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025982 (Sf3b1) NM_031179 splicing factor 3b, subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1932339]

 
Come back to gene ENSMUSG00000025982


For any suggestions or comments, please send an email to unitrap@crg.es