Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST170796
Clone ID OST170796
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST170796
Sequence
GACTGAGCGTGCGATTGACCGCCAGNANNACGACGAGACGAAGACTTGTCGGACGTGGAGGAAATTGTCAGCGTCCGTGG
CTTCAGCCTGGAGGAGAAGCTACGTAGCCAGTTATACCAGGGGGACTTCGTGCATGCTATGGAAGGCAAAGATTTTAACT
ATGAAANACANNACAGAGAGAAGCTCTCAGGNNCCCCCTGGTTTTTCGGGACAAGGATGGACTAGGGATCAAGATGCCAG
ACCCTGATTTCACAGTCCGAGACGTCAAACTCCTGGNGNGGNGCCACCGATNGCGTGANNGTNAANGANCACNGCCATCC
TCCNTGGGAANCNAGCNTGATNNTGNTCCNGTCCGGCGCGCTNGTACCAAACACCNACNGGNCNGGGGANNAAACNGTCC
CTNGTGCTGNTNCTCNAGATGGGNCTGATGTNNCTATCAATGCTAAGGNCTCGATCNTTTNGTNTNGGTCCAACCCAGCG
ANCTNCTATACAGTNCCACCCTGCTTACTAAACCCCCGTTTTCTACCGAGTACG
Sequence Type mRNA
Unitrap ID UNI13030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123432789..123437817 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es