Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRZ663
Clone ID RRZ663
Vector pGT2Lxf
Project baygenomics

Sequence tag RRZ663
Sequence
TTTCCGGTGGCTGGTTGCGCTCGCTCACCCCAGCTGCAGCCACTCTCTCCCGCGGCTGCTTCCTCCATCCTGGTATTTTT
TGGAGCCTCCATCCTGGTTCTTCCAAAGTGCCCGGACCCAAAACAGGAA
Sequence Type mRNA
Unitrap ID UNI6927

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9161614..9161742 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042508 (Dmtf1) NM_011806 cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]

 
Come back to gene ENSMUSG00000042508


For any suggestions or comments, please send an email to unitrap@crg.es