Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST170734
Clone ID OST170734
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST170734
Sequence
GAGGCCTCGAAGTACCAGGAAAATCTACAGTGGAAGATGAGGACAGCATGGNTGGACTGGAGACGACGGAAACAGAAAAT
ATTGTGGAGACAGAANTCAAAGAACAATCTGTGGAAGAGGATGCATGAANCAGAAGNGGANAGCAGCAAACAGCCAGTCT
CAGCCTCTTCAGCGGTCTGTGTCTGAGGAATCTGCAAACTCCCTGNTCTCTGTTGGCGTAGAAGCCANNATCANGTTAGA
ACTGGACTACAGACACCGACAGGGGANAGGGNGGTATACTGACTGGAGACAGGGCTTGGACCTGGGTGGGACTTTATCAT
TTTAGTCACCTTATGTTTGACACCCCTGTGTGATGTTGGCACAGATGTTGACTATGCTATGGACTTTGGTGACTGGATAG
CAGGGAGTATGCTAGGATAGTGCTCTAGTCACTCTANATGAGCATCTGGATGGCAGTATGCTTCCTGACTGAAGAAGTAG
CCAAGAGCTCCTAAAGTAAGAATTAAGTTTGGGGGGCGGGGGCCAAGAGACAGTTTTATCAGAGGAACCAGGTTTTGTTT
Sequence Type mRNA
Unitrap ID UNI19017

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24920378..24949728 438
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038056 (Mll3) NM_001081383 myeloid/lymphoid or mixed-lineage leukemia 3 Gene [Source:MGI Symbol;Acc:MGI:2444959]

 
Come back to gene ENSMUSG00000038056


For any suggestions or comments, please send an email to unitrap@crg.es