Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST170461
Clone ID OST170461
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST170461
Sequence
GACTGAGGAAATAATGCAAAAGGTGTCTCAAGGCTCCTGACCAGTGAACAGAGATTTGAGAAAGACAGCCAAGCTCATGT
TTTCTCCTGATCAAGAAAATCATCCTTCCAAAGCCCCAGTAAAATATGGCGAACTCATTGTCTTAGGATATAANGGATCT
CTCCCAAACGGTGATAGAGGAAGGAGGAAAAGTAGGTTTGCTTTGTTTAAAAGACCTANGGCANATGGGGTGAAGCCTAG
CACCGTGCACATTGCATGTACTCCTNAGGCTGCCAAGGCAATAAGCAACAAGGACCAGCATAGCATATCATATACTTTAT
CTCGAGCCCAGACGGNGGTGGTTGAATATACTCATGACAGCAACACTGATATGTTTCAGGGACTATAACATTATTGNTTT
TTTTTTTTTAAAAAAGTTAAAAATCTGTTGTTGGTGACTTTGCTATGACTAGATTAAATATTATGCTTTCATGCTG
Sequence Type mRNA
Unitrap ID UNI22384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21036047..21042757 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020134 (Peli1) NM_023324 pellino 1 Gene [Source:MGI (curated);Acc:Peli1-001]

 
Come back to gene ENSMUSG00000020134


For any suggestions or comments, please send an email to unitrap@crg.es