Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRZ557
Clone ID RRZ557
Vector pGT2Lxf
Project baygenomics

Sequence tag RRZ557
Sequence
CACCCAACAAATACCCCATCTTCTTCTTTGGAACGCATGAAACGGCCTTCCTGGGACCCAAGGACCTGTTCCCCTATGAT
AAGTGCAAGGACAAGTACGGAAAGCCCAACAAGAGGAAAGGCTTCAATGAGGGGCTCTGGGAGATCCAGAACAACCCCCA
TGCCAGCTACAGTGCGCCTCC
Sequence Type mRNA
Unitrap ID UNI6936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56221557..56221837 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002833 (Hdgfrp2) NM_008233 hepatoma-derived growth factor, related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1194492]

 
Come back to gene ENSMUSG00000002833


For any suggestions or comments, please send an email to unitrap@crg.es