Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRZ512
Clone ID RRZ512
Vector pGT2Lxf
Project baygenomics

Sequence tag RRZ512
Sequence
CTGCAGGGGGAAACGGCGTGTCTGGAGCGGAAATTTTTCCCAACACAACTTCTCGGAGGCAACATATTGGAAGGGACTCG
GGGAGGCCGGAGTCCAAATGGAAGTGGCTGAAAGAAACTTCTCGCCCTGCTGATTCTGAGC
Sequence Type mRNA
Unitrap ID UNI6937

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93747188..93747327 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059474 (Mbtd1) NP_598773 mbt domain containing 1 Gene [Source:MGI (curated);Acc:Mbtd1-009]

 
Come back to gene ENSMUSG00000059474


For any suggestions or comments, please send an email to unitrap@crg.es