Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRZ510
Clone ID RRZ510
Vector pGT2Lxf
Project baygenomics

Sequence tag RRZ510
Sequence
GGGGCATGAATGTTGCTGCTCATCTAGTGATCATCATGGATACTCAGTACTACAATGGCAAGATCCATGC
Sequence Type mRNA
Unitrap ID UNI6938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 127060739..127060808 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003660 (Ascc3l1) NM_177214 activating signal cointegrator 1 complex subunit 3-like 1 Gene [Source:MGI (curated);Acc:Ascc3l1-001]

 
Come back to gene ENSMUSG00000003660


For any suggestions or comments, please send an email to unitrap@crg.es