Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST169609
Clone ID OST169609
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST169609
Sequence
GAGGACCTGAACCAGGCCCCCCAACCCCAAGCAGATGAGGGGCCTCCAGGCCGCTCCATCGGGGGGATCTCACCCAACCT
GGGTGCCTTGGACTTGCTAGGCCCAGCCACTGGCTGTCTGCTGGACGATGGACTGGAGGGCCTGTTTGAGGA
Sequence Type mRNA
Unitrap ID UNI12064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28274650..28274801 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008384 (Sertad1) NM_018820 SERTA domain containing 1 Gene [Source:MGI (curated);Acc:Sertad1-001]

 
Come back to gene ENSMUSG00000008384


For any suggestions or comments, please send an email to unitrap@crg.es