Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST169550
Clone ID OST169550
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST169550
Sequence
GACTGAGGTCGATGACAGTGAGAAGCATGCTTTCCACTGCTCTCCCTGGTCCCAGTTGCCACCCAGGNCCCCCAGCCCCC
AACACTAACCCCTTCCTCCTATAATCCAGGGTAGGAGGGAGGCCTGGTTCAGCTGGCTTCCCCAATTTCTGCTCCCTGGG
AGATCAGTATTGTGAGTGCATGTGAAATGGGGGGGCCCTCCCCCACAGTGCCCTTCCCCCTCCTGGNGCCCACTCACACT
ACACCCTCTTCCCAAGTCCCCACCCCACCTCCCCTTGAGAAAAACTGGACATGGGGATGGGGAGGGGAGCCGGCCAGAGG
AGGACCCTTTTCTGTGGCATTANATGGGGGAGGGACAGCTG
Sequence Type mRNA
Unitrap ID UNI25705

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5049329..5049639 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035203 (Epn1) NM_010147 epsin 1 Gene [Source:MGI (curated);Acc:Epn1-001]

 
Come back to gene ENSMUSG00000035203


For any suggestions or comments, please send an email to unitrap@crg.es