Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XC348
Clone ID XC348
Vector pGT1Lxf
Project baygenomics

Sequence tag XC348
Sequence
TAGTCCGCGGGAAACCAAAATGGCGAAGGGCTGTTGCGAAGTGGTCTGTGTTTGAGGCCGGTGTGAGCACGCACATTCTC
CTTCCTAACCCTCGTCCCCAAGGAACTCGGTGTGTGTGTGCGTGTGCGCAGGGCTCCCGCTGGGGCGGGTGCCCAGGGAG
TGCCCGGACTTGCGGGGGAGCGCCCACGGGAACGAAGTATTGCTTCTATTTTCCTGTATCAAGCGGTTGGCACCACTTCA
GTGGCCGCATA
Sequence Type mRNA
Unitrap ID UNI796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108494734..108494981 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es