Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH046
Clone ID XH046
Vector pGT1Lxf
Project baygenomics

Sequence tag XH046
Sequence
GTCTATATAAGCACAGGAGCAAAAGTCTGGGACAGAGAACAAGATAGAAAGTCCAAGGAGAA
Sequence Type mRNA
Unitrap ID UNI49

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 94157236..94157292 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020863 (3300001P08Rik) NM_026313 RIKEN cDNA 3300001P08 gene Gene [Source:MGI Symbol;Acc:MGI:1914934]

 
Come back to gene ENSMUSG00000020863


For any suggestions or comments, please send an email to unitrap@crg.es