Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0193
Clone ID DC0193
Vector pGT1lxr
Project sanger

Sequence tag DC0193
Sequence
GACAAACGAAGAGACAAGAATCTTTCCTAGCTGAGACTGACATTCAATACTGGCTCTCCCTCCACTCCTCTGCCTATCTT
CTTCCGACCTCCCTCTCATGCGCTGTAGCTGCTCTCTGCTTCCCTTTATCCCCTCTCCTTCCCCTCGATTATTATTTCCG
CATCATGCCCCCCACGATCCCCCATACTCTGATGATGACTCCTATCCTCCCGTTTCTCATTCGATCTCCGTCCGCTCCCC
AGGAGGAGGAAGAAGGGAAGACCATCTCAGCCGAAGTCTGTGGAGGATCTCCTGGACCGGATCAACCTGAAAGAACACAT
GCCCACCTTCCTGTTCAATGGCTATGAAGACCTGGACACCTTCAAACTCCTGGAGGAAGAAGACTTAGATGAATTAAATA
TCAGGGACCCAGAACACAGAGCAGTTCTTCTGACTGCGGTGGAGCTGTTGCAGGAATATGACA
Sequence Type mRNA
Unitrap ID UNI689

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 8459119..8460045 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015305 (Sash1) NM_175155 SAM and SH3 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1917347]

 
Come back to gene ENSMUSG00000015305


For any suggestions or comments, please send an email to unitrap@crg.es