Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST169201
Clone ID OST169201
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST169201
Sequence
AACTGAGCAACACCAAGAAGGAGGGGGACTTGTTGGCTGCGCAGGCCCGGCTCAAGGACCTCGAGGCTCTTCTCAACTCC
AAGGAAGCTGCCCTGAGCACTGCTCTCAGTGAGAAGCNGCACATTGGAGGGCGAGCTCCATGACCTGCGGGGGCAGGTAG
CCAAGCTTGAGGCTGGCCCTGGGAGAGGCTAANAAGCAGCTTCAGGATGAGATGCTGAGGCGAGTGGATGCTGAGAACAG
GCTACAGACGCTGAAGGAGGAGCTTGACTTCCAGAAGAACATTTACAGCGAGGAACTGCGTGAGACCAAGCGCCGGCATG
AGACGCGGCTTGTGGAGATCGATAACGGGAAGCAGCGAGAGTTTGAGAGCCGGCTGGCAGATGCCCTGCAGGAGCTGCGG
GCTCAGCATGAGGACCAGGTGGAACAGTATAAGAAGGAGCTAGAAAAGACNTACTCCGCCAAGCTGGATAANGCCAGGCA
GTCTGCTGAGAGGAACAGCAACCTCGTGGGGGCTGCCCATGAGGAACTGCANNAGGGCATCTTTCTATTTC
Sequence Type mRNA
Unitrap ID UNI25496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88290184..88292355 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es