Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST168919
Clone ID OST168919
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST168919
Sequence
ACTGAGGATATGGTGGCACGGGAGGGAGGCTGNATAGTGGATTATTTCCACATTTTTGGTCAAGGACAGCGATATCTCAA
TAGGAGGAACTGGGCAGGAGCAGGGCATTCTCTCCAGCAGGTGAGTGGTCACTGANTACTACAACTCCAACCCGAAGGCC
ATNACTACGGGCGTTAAATGGCCGATTCAGGCTTACCGCCGGAACACATCCAGCCCTCCGCCAGCACACATNGGTGTTTG
GAGAAGTCACACCATTTCCCATTTTCTGAANACATTGCGTCACAAGGCTTGACCTGCGTCTTCAAGACAGATGTTTANAT
GAACTGTCAACGATATTCTATATTTTTAAAGATTGCATTCGTGTC
Sequence Type mRNA
Unitrap ID UNI25726

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97632795..97634131 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018543 (1700001P01Rik) NM_028156 RIKEN cDNA 1700001P01 gene Gene [Source:MGI Symbol;Acc:MGI:1919465]

 
Come back to gene ENSMUSG00000018543


For any suggestions or comments, please send an email to unitrap@crg.es