Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST168423
Clone ID OST168423
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST168423
Sequence
ATTTCTTGGGAAGAGAAGAAACATTTGGTTGCTACTGTAGATTTACATGATTACGAGGCAGCTTTAATTGCCATGATTCC
CCTCCCCACTCTGGACGCCTAANAACCTTCAGGACCACAGACCTCACTTCTGGAGTTGCANAANAGAGCATATCCCTGTC
TGATTTAATCACCATACTTATTTAA
Sequence Type mRNA
Unitrap ID UNI894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74698908..74699092 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

 
Come back to gene ENSMUSG00000024067


For any suggestions or comments, please send an email to unitrap@crg.es