Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST168333
Clone ID OST168333
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST168333
Sequence
GACTGAGGATGATGGTGACCCTCGTGTCCCGTAAAGGAATCCCCCCGTGGGTGAAAGTTCCTGAAGACCTGAAAGANCCA
GAAGTATTCCAGGNCCAGTCGCTGGNGCTGAAATATCTGTTTGGCCCACAGGGATCTCGAATGTCTCACATCGAGCAGGT
GAGCCAGGCCATGTTTGAGCTGAANAACCTGGAATCTCCCGAAGAACTTATCGAGGNCTTCATTTTTACCGGGCTTTCTT
CAAAAAACAACAAGATTCGGGCTAAATGGATGCTTCAGTCCATGGCTTGAGAGGTACCACCTGCCCCAGCAAAAAGGAGT
GCTGAAGCTGGAGGAATCCATGAAAACCCTGGGAGCTTAGGCCCAGTGTATCGNGGGGAAGCCCAGTTTTCCCAGCCCCC
TTTGNGTNCTCCCCNACCCTTGGANNNCGGGTTAAGCTGGGGCCCAGGGGTTTGGTTTTTGGCGGGGAATTTTTAA
Sequence Type mRNA
Unitrap ID UNI13658

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78215034..78215909 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060461 (Dppa5a) NM_025274 developmental pluripotency associated 5A Gene [Source:MGI (curated);Acc:Dppa5a-001]

 
Come back to gene ENSMUSG00000060461


For any suggestions or comments, please send an email to unitrap@crg.es