Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone KST286
Clone ID KST286
Vector pGT1TMpfs
Project baygenomics

Sequence tag KST286
Sequence
GTACTGATGTCTCGGGCCAAGGCATCATGCCATCTCTGCTAAACTGANTAANCCCTNCCTGTTTGATNCCAAGCCTCTCA
TTGTTCAGTATGAGGTTAATTTTCAGAATGGAATAGAATGTGGTGGTGCCTATGTGAAGCTGCTTTCCAAGACGGCAGAG
CTCAGCCTGGATCAATTCCACGACAAGACTCCCTATACTATTATGTTTGGTCCAGATAAGTGTGGAGAGGACTACAAACT
GCATTTCATCTTTCGACACAAAAATCCCAAGACAGGTGTATATGAAGAAAAACATGCTAAGAGGCCAGATGCAGATCTGA
AGACCTATTTCACTGACAAGAAAACGCATCTTTATACATTA
Sequence Type mRNA
Unitrap ID UNI6967

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50120973..50122375 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]

 
Come back to gene ENSMUSG00000020368


For any suggestions or comments, please send an email to unitrap@crg.es