Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone KST290
Clone ID KST290
Vector pGT1TMpfs
Project baygenomics

Sequence tag KST290
Sequence
TACCCNTGGAGAAGGCAAGCTCTCCCTGCNTGGCTGCTCAACAAGGAGCTGGGCTGCATCAACTCGCCCCTGCAGATTGA
TGACGACTTCTGCGGGCAGGATTTCAACCCAGCCACTGGGTGGCACGGTCACCATCGAGGGCACACCCCTTTTTGTGGAC
AAGGAAGATGGCCTGACTGCTGTGGCTGCCTATGACTACCAAGGCCGCACCGTGGTTTTTGCTGGCACTCGCAGCGGCCG
CATCCGCCAGGTCGCATCCTGGAATAATAATCTCATGACCAAAATCC
Sequence Type mRNA
Unitrap ID UNI6966

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 89304847..89306515 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030084 (Plxna1) NM_008881 plexin A1 Gene [Source:MGI Symbol;Acc:MGI:107685]

 
Come back to gene ENSMUSG00000030084


For any suggestions or comments, please send an email to unitrap@crg.es