Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone KST268
Clone ID KST268
Vector pGT1TMpfs
Project baygenomics

Sequence tag KST268
Sequence
GGAGGCGGCAGGAAGGGAAGGGCGCTGCGACCAGTGGCGGGCGGGATTCGCGTTCCGAGACCCACGGGAGCACGAAGTTT
CCGCGCACCGTCTCACGCACGGCGACTGGGACCGTCCAGTGTCCGGCTTTGCCTTCGGTTTTTCTCCGTTGTGACTCGTG
CAACGTGTGGCCAGCGGCCACGCGGAGGCGACGAGGAGCTGCACGTCAG
Sequence Type mRNA
Unitrap ID UNI6970

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11937195..11937403 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]

 
Come back to gene ENSMUSG00000020176


For any suggestions or comments, please send an email to unitrap@crg.es