Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST168053
Clone ID OST168053
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST168053
Sequence
CCAGTTTGATCAGGTGGTCGTGCTCAACCAGCTGCGCTACTCGGGGATGCTGGAGACGGTGAGGATTCGGAAAGCAGGGT
ATGCCGTCAGAAGACCCTTTCAGGACTTTTACAAAAGGTATAAAGTGCTGATGAGGAACTTGGCCCTGCCTGACGACATC
CGAGGGAAGTGCACTGTGCTCCTGCAGGTCTATGACGCTTCTAACAGCGAGTGGCAGCTGGGGAAGACCAAGGTCTTCCT
TCGAGAATCCTTGGAGCAGAAACTGGAAAAGAGGCGGGAAGAGGAGATTGACCGTGCGGCCATGGTGATCCGAGCTCACA
TCTTAGGCTACTTGGCACGAAAGCAATATAGAAAGGTCCTCTGTGGTGTGGTGACCATTCCAGAAGAATTACAGAGCTTT
CCTTGCGAGGAAGAANTTTTTGCACCTGAAAAAAGGCAGCCATCGTGTTCCAGAAGCAACTGCGAGGACAGCTGGCACGC
ANGGTTTACAGGCAGCTGTTGGCTGAAAAAC
Sequence Type mRNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25705784..25709507 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es