Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST167626
Clone ID OST167626
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST167626
Sequence
TGAGGAGAATGGCAAGAATGAAGAGATTCTGAATTCCCTCAAGTACGTCCGACCTGGTGGCGGGTTCGAGCCCAATTTTA
CATTGTTTGAGAAGTGCGAAGTGAATGGTGAGAAGGCTCACCCGCTCTTTACCTTCCTGCGGAATGCCTTGCCAACACCC
AGTGACGACCCCACTGCGCTCATGACCGACCCCAAGTACATCATTTGGTCTCCGGTGTGCCGCAACGACATTGCCTGGAA
CTTTGAGAAGTTCCTGGTGGGCCCCGACGGTGTTCCCGTGCGCAGGTACAGCCGCCGNTTTCGTACCATCGACATCGAAC
CTGACATAGAAACCCTGCTGTCCCAGCAGTCTGGCAACTCCTAAGGCGGCCCTGGCATTGGCTTGGTGATTACTGGCTGC
ACTCTGGGGGGCGGTTCTTCCATGATGGNGTTTCCTCTAAATTTGCACGGANAAACACCTGATTTCCAGGAAAATCCCCT
CA
Sequence Type mRNA
Unitrap ID UNI12653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108242106..108242585 474
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063856 (Gpx1) NM_008160 glutathione peroxidase 1 Gene [Source:MGI Symbol;Acc:MGI:104887]

 
Come back to gene ENSMUSG00000063856


For any suggestions or comments, please send an email to unitrap@crg.es