Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRX058
Clone ID RRX058
Vector pGT0Lxf
Project baygenomics

Sequence tag RRX058
Sequence
GCAAATATGAGGAGATGTACCCTCCAGAAATAGGTGACTTCGCCTTTGTGACTAACAACACGTACACTAAGCACCAGATC
AGACAGATGGAGATGAAGATTCTCAGAGTTCTGAACTTCAGCCTGGGTCGCCCTCTGCCTCTGCACTTCCTCCGTAGAGC
ATCTAAAGTCGGAG
Sequence Type mRNA
Unitrap ID UNI4630

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101551115..101551288 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041431 (Ccnb1) NM_172301 cyclin B1 Gene [Source:MGI (curated);Acc:Ccnb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 118615027..118615200 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000084133 (AL606922.5)  

 
Come back to gene ENSMUSG00000084133


For any suggestions or comments, please send an email to unitrap@crg.es