Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST167415
Clone ID OST167415
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST167415
Sequence
CATCAGAAAGAGCAGTGGGAGTGGAGCCAGCAGTGTGGTACAGAGGCCCTTCCGAGATCGGGTGCTACACCTCCTGGCCC
TGAG
Sequence Type mRNA
Unitrap ID UNI25758

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73105545..73105628 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070002 (Ell) NM_007924 elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]

 
Come back to gene ENSMUSG00000070002


For any suggestions or comments, please send an email to unitrap@crg.es