Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRZ154
Clone ID RRZ154
Vector pGT2Lxf
Project baygenomics

Sequence tag RRZ154
Sequence
GGGGCATGGTGACCGGGAAGGCCGGGAAGTCCAAGTCAGCCGAGGATCTGCTGGAGCGCTCCGACACACTGGCGGTCCCT
GTGCATGTGAGGTCCAGGTCGTCTCCCACCTCCGACAAGAAAGGTCAGGATGTGCTCCTGAGGGAAGGCAGCAACTTTGG
TTTTGTAAAGGATCCATGCTGTTTGGCTGGCCCTGGACCT
Sequence Type mRNA
Unitrap ID UNI6987

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93372038..93377501 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es