Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRZ243
Clone ID RRZ243
Vector pGT2Lxf
Project baygenomics

Sequence tag RRZ243
Sequence
TGCAAAGGACACCGGCACTGGGTCCTTAGCATATCCTGGTCCCCAGATGGCAAGAAACTGGCCTCAGGCTGCAAGAATGG
CCAGATTCTGCTGTGGGACCCAAGCACGGGGCTGCAGGTGGGCAGGACCCTCACTGGCCACAGCAAATGGATCACAGGCC
TGAGCTGGGAGCCCCTTCACAT
Sequence Type mRNA
Unitrap ID UNI7000

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 82718780..82719087 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020692 (Nle1) NM_145431 notchless homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Nle1-001]

 
Come back to gene ENSMUSG00000020692


For any suggestions or comments, please send an email to unitrap@crg.es