Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST166448
Clone ID OST166448
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST166448
Sequence
GACTGAGGATGTGATAGGCNGGTTCTGCCTGAGCGACGACGACAGCGTTTGANTATGAAGATGANGATGGTGATAGGATT
ACAGTAAGAAGCGATGAAGAGATGAAGGCAATGCTGNCCTACTATTATTCCACAGTAATGGAACAGCAAGTAAATGGCCA
GCTAATAGAGCCGCTGCAGATATTTCCAAGAGG
Sequence Type mRNA
Unitrap ID UNI25786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63191193..63219594 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058444 (Map2k5) NM_011840 mitogen-activated protein kinase kinase 5 Gene [Source:MGI Symbol;Acc:MGI:1346345]

 
Come back to gene ENSMUSG00000058444


For any suggestions or comments, please send an email to unitrap@crg.es