Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST166183
Clone ID OST166183
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST166183
Sequence
TGTGAAGAGTTTTTGCTCTTCAGTGACAATACTGATGAAGAGGTGTTAGACTTGCAACACTGGACTGGACAGTGAACTCT
GAGCTTGCTACTGCTCTAGTTTGNTGGAATTNGTGGCTCTGTGNCCAGCTACTGGCTCCTACAGACCGGANGAAGCAGAT
TGNAGACAGAAGTGGGAGAAAGCCTCCAGCTGGNACATTCTCAGAAGGGTAGNCCTCTTGGCTGNTGGGCCCTGTCCAGC
CTGCCTTATGGAGAAGATGAACTGGTTATCCCAAAGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI25794

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 112538652..112540139 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044465 (4632419K20Rik) NP_950174 family with sequence similarity 160, member A2 Gene [Source:MGI Symbol;Acc:MGI:1921599]

 
Come back to gene ENSMUSG00000044465


For any suggestions or comments, please send an email to unitrap@crg.es