Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST165696
Clone ID OST165696
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST165696
Sequence
ACTGAGGTGGAAGAAGAAGCGATTCAGACCCTATGGAGAAGAGAATGACGAGCAAGGAAATTTTTCTAGAAGAAAGATTG
TCTCCAACTGGGATCGCTATCAAGATACTGAAAAGGAGGTCAATGGTGAAAGTGGAGAATCTCAGCGGGGCACAGACTTC
AGTGTCCTCCTGAGCTCTGCAG
Sequence Type mRNA
Unitrap ID UNI2675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112354605..112354784 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003604 (Aven) NM_028844 apoptosis, caspase activation inhibitor Gene [Source:MGI (curated);Acc:Aven-001]

 
Come back to gene ENSMUSG00000003604


For any suggestions or comments, please send an email to unitrap@crg.es