Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST165415
Clone ID OST165415
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST165415
Sequence
GACTGAGGGGCTCCGTGTGATTGAGCTGGANAAGCATATCTCCCTCCTCCATGAGTACAATGACATCAAGGATGTATCAC
AGATGCTGCTGGGGAAGCTGGCTGTGACTCGAGGCGTTACCACCAAGGAGTTATATCCAGATTTTGATCTAAACCTGAAT
GACTGAGCAGCTTCTTGGAGATTTTCATCTACAGCCCACAGGGACAGGAGGATGGGGGCATAAAAGGCAGAGTCTAGACA
GTATGTTCATATGGTTTTCANATTTTAAAAGATGCTAGAAGCCCTCCAAAGTTTGGGGTGGGTTCTAGAGAANAGGAGTA
TTGGGAGGGGGTGGGTATTG
Sequence Type mRNA
Unitrap ID UNI18011

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32134414..32136325 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044627 (2900010J23Rik) NP_780399 RIKEN cDNA 2900010J23 gene Gene [Source:MGI Symbol;Acc:MGI:1920181]

 
Come back to gene ENSMUSG00000044627


For any suggestions or comments, please send an email to unitrap@crg.es