Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRY210
Clone ID RRY210
Vector pGT2Lxf
Project baygenomics

Sequence tag RRY210
Sequence
CACGGCAGACGGCGGAGGAGTCAGGAATAACAAACTCTGCTTCTAGCACTCTCCTGTCTGAGTACAATGTCACAAACAAC
AGCATCGCTCTGAGAACACCACGGACACCAGCCTCTCAAGACAGGATTCTA
Sequence Type mRNA
Unitrap ID UNI7034

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45552505..45552635 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023932 (Cdc5l) NM_152810 cell division cycle 5-like (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918952]

 
Come back to gene ENSMUSG00000023932


For any suggestions or comments, please send an email to unitrap@crg.es