Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRY122
Clone ID RRY122
Vector pGT2Lxf
Project baygenomics

Sequence tag RRY122
Sequence
TTTCTCTCAGTTTGGGGTCAGCGATTGTTATGGATTTCAAGCATCCAGAGGGTGTCACAGTACAAGTTATGTTACCTCGT
CGGAGTTTGCTGGTGATGACAGGAGAATCTAGATACCTTTGGACTCATG
Sequence Type mRNA
Unitrap ID UNI7037

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3349468..3359589 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025899 (Alkbh8) NM_026303 alkB, alkylation repair homolog 8 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1914917]

 
Come back to gene ENSMUSG00000025899


For any suggestions or comments, please send an email to unitrap@crg.es