Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST164894
Clone ID OST164894
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST164894
Sequence
GACTGAGGTACATGTGACAACGCCGCAGCTATGAGTGGAATTTTAAAGAGGAAGTTCGAAGATGTGGACGCCTCCTCACC
ATGCTCCTCTGCTCGGGAATCGGATGATGAAGTCTCCAGCAGCGAAAGTGCTGACAGCGGGGATAGCAGTNAATCCATCC
ACCTCAAATCACTTCACCCCTTCCTCCATCCTGAAAAGGGAGAAACGGGCTGAGGACNAANAATGTACACTTCAGCTGTG
NCACCGNGTACTACTTCACCAGGAGGCAGGGCTTCACTAGTGNGCCCAGCCAGGGNGGCAGCACTCTGGGGATGTCCAGT
CGTNACAACAGCGNGCGCCAGTACACCCTGGGCGAGTTTGCGCGAGAGCAGGAGCGCCTGCACCGGNAGATGCTGAGAGA
ACACCTCCGGGAGGAGAAACTCAACTCTCTCAAACTAAAG
Sequence Type mRNA
Unitrap ID UNI25810

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 65787014..65840619 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044647 (Csnrp3) NM_153409 cysteine-serine-rich nuclear protein 3 Gene [Source:MGI Symbol;Acc:MGI:1925021]

 
Come back to gene ENSMUSG00000044647


For any suggestions or comments, please send an email to unitrap@crg.es