Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRY135
Clone ID RRY135
Vector pGT2Lxf
Project baygenomics

Sequence tag RRY135
Sequence
CCCCTTCCCTCCTAGCGGACCCTTGTGCCCTGGAAGACCTGCCAGATCTGGAACCAAACATGTCAGGAGCAGCAATTTTA
ACTTCAAAGAACATTAATGAGAATCCTGTAAGCCAAAATTTGAAGAGCGCTTGTGATGACAAATTCCAACTACAACATCT
GGAGGGTCCCACCAGTGGAGATGACGAGTCAGGGATGGGAAGGTCCCAGGT
Sequence Type mRNA
Unitrap ID UNI7042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101374032..101378656 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es